Research Article: In Situ Monitoring of MicroRNA Replacement Efficacy and Accurate Imaging‐Guided Cancer Therapy through Light‐Up Inter‐Polyelectrolyte Nanocomplexes

Date Published: January 19, 2018

Publisher: John Wiley and Sons Inc.

Author(s): Xiongwei Deng, Zhaoxia Yin, Jianqing Lu, Xianlei Li, Leihou Shao, Caiyan Zhao, Yishu Yang, Qin Hu, Yan Wu, Wang Sheng.

http://doi.org/10.1002/advs.201700542

Abstract

Replacement of downregulated tumor‐suppressive microRNA (Ts‐miRNA) is recognized as an alternative approach for tumor gene therapy. However, in situ monitoring of miRNA replacement efficacy in a real‐time manner via noninvasive imaging is continually challenging. Here, glutathione (GSH)‐activated light‐up peptide‐polysaccharide‐inter‐polyelectrolyte nanocomplexes are established through self‐assembly of carboxymethyl dextran with disulfide‐bridged (“S—S”) oligoarginine peptide (S‐Arg4), in which microRNA‐34a (miR‐34a) and indocyanine green (ICG) are simultaneously embedded and the nanocomplexes are subsequently stabilized by intermolecular cross‐linking. Upon confinement within the robust nanocomplexes, the near‐infrared fluorescence (NIRF) of ICG is considerably quenched (“off”) due to the aggregation‐caused quenching effect. However, after intracellular delivery, the disulfide bond in S‐Arg4 can be cleaved by intracellular GSH, which leads to the dissociation of nanocomplexes and triggers the simultaneous release of miR‐34a and ICG. The NIRF of ICG is concomitantly activated through dequenching of the aggregated ICG. Very interestingly, a good correlation between time‐dependent increase in NIRF intensity and miR‐34a replacement efficacy is found in nanocomplexes‐treated tumor cells and tumor tissues through either intratumoral or intravenous injections. Systemic nanocomplexes‐mediated miR‐34a replacement significantly suppresses the growth of HepG‐2‐ and MDA‐MB‐231‐derived tumor xenografts, and provides a pronounced survival benefit in these animal models.

Partial Text

MicroRNA (miRNA) represents a class of endogenous, small, and highly conserved nonprotein‐coding RNAs that acts as post‐transcriptional gene regulators in almost all physiological process.1 It has been proposed that aberrant expression of miRNA was strongly associated with numerous biological processes as well as pathological processes.2 Dysregulation of miRNA has been discovered in almost all types of human cancers, which may function as either tumor suppressors or oncogenes.3 More importantly, rectification of miRNA abnormality by miRNA replacement has emerged as one of novel strategies for alternative miRNA‐based tumor therapy.4 However, transportation of miRNA to the tumor sites is still dramatically hindered by multistage biological barriers including enzymatic degradation, clearance in blood, and poor cellular uptake.5 A variety of established nanostructures have been successfully developed so far for miRNA delivery, including liposomes/lipids, polymeric micelles, inorganic/metal nanomaterials, and DNA/RNA assembly nanostructures, which have drastically facilitated the clinical translation of miRNA replacement therapy.6, 7, 8, 9

In summary, we have successfully developed NIRF light‐up peptide‐polysaccharide‐inter‐polyelectrolyte nanocomplexes constructed by S‐Arg4 peptides and CMD via a self‐assembly approach. The confinement of ICG in the established nanocomplexes led to self‐quenched NIRF through an ACQ mechanism. The dissociation of nanocomplexes in tumor cells can be induced by intracellular GSH and efficiently trigger the release of miR‐34a and ICG, in which the NIRF signal of ICG was reversibly activated upon its release. ICG and miR‐34a may be delivered into tumor tissues by the nanocomplexes though EPR effects and efficiently uptaken by tumor cells. Of particular significance, NIRF intensity of ICG is correlated with the released amount of miR‐34a and miR‐34a replacement efficacy both in vitro and in vivo, either by local or systemic injections of CMINs. In addition, replacement of miR‐34a with CMINs resulted in efficient tumor‐suppressive effects both in vitro and in vivo. The overall data demonstrated that the established nanocomplexes have a great potential to be used as a light‐up theranostic platform with excellent biocompatibility for real‐time monitoring of miR‐34a replacement efficacy and accurate imaging‐guided therapy strategy against tumor.

Materials and Reagent: CCK‐8 kit and ICG were purchased from Dojindo Molecular Technologies (Tokyo, Japan). 4,6‐diamidino‐2‐phenylindole (DAPI) was purchased from Sangon Biotech (Shanghai, China). S‐Arg4 was synthesized by ChinaPeptide Co., LTD (Shanghai, China). Dextran (Mw ≈ 27 KDa), GSH, BSA and EDC were brought from Sigma‐Aldrich (St. Louis, MO, USA). CMD (degree of substitution of carboxymethylation ≈ 70%) was synthesized according to a previously reported procedure.1 All miRNA mimics (with or without cyanine‐3 (Cy‐3) label at 5′ end) used in the human species were synthesized and provided by RiboBio Co. (Guangzhou, China). The sequences of miR‐34a and scramble miRNA are 5′‐UGGCAGUGUCUUAGCUGGUUGU‐3′ and 5′‐UCACAACCUCCUAGAAAGAGUAGA‐3′, respectively. Trypsin‐EDTA, fetal bovine serum (FBS), and penicillin/streptomycin were purchased from Invitrogen (USA). Antibodies were purchased from Abcam, Inc. The PCR primers were synthesized by Sangon Biotech (Shanghai). RNase‐free deionized water was provided by TIANGEN Biotech Co. Ltd (Beijing). The miRNA mimics were dissolving in RNase‐free deionized water. All other chemicals and solvents were of analytical grade commercially available unless specially mentioned otherwise. Ultrapure water (deionized (DI) water) was supplied by a Milli‐Q water system (Millipore, Bedford, MA, USA).

The authors declare no conflict of interest.

 

Source:

http://doi.org/10.1002/advs.201700542

 

Leave a Reply

Your email address will not be published.