Research Article: Matrix Rigidity‐Dependent Regulation of Ca2+ at Plasma Membrane Microdomains by FAK Visualized by Fluorescence Resonance Energy Transfer

Date Published: December 18, 2018

Publisher: John Wiley and Sons Inc.

Author(s): Tae‐Jin Kim, Lei Lei, Jihye Seong, Jung‐Soo Suh, Yoon‐Kwan Jang, Sang Hoon Jung, Jie Sun, Deok‐Ho Kim, Yingxiao Wang.

http://doi.org/10.1002/advs.201801290

Abstract

The dynamic regulation of signal transduction at plasma membrane microdomains remains poorly understood due to limitations in current experimental approaches. Genetically encoded biosensors based on fluorescent resonance energy transfer (FRET) can provide high spatiotemporal resolution for imaging cell signaling networks. Here, distinctive regulation of focal adhesion kinase (FAK) and Ca2+ signals are visualized at different membrane microdomains by FRET using membrane‐targeting biosensors. It is shown that rigidity‐dependent FAK and Ca2+ signals in human mesenchymal stem cells (hMSCs) are selectively activated at detergent‐resistant membrane (DRM or rafts) microdomains during the cell–matrix adhesion process, with minimal activities at non‐DRM domains. The rigidity‐dependent Ca2+ signal at the DRM microdomains is downregulated by either FAK inhibition or lipid raft disruption, suggesting that FAK and lipid raft integrity mediate the in situ Ca2+ activation. It is further revealed that transient receptor potential subfamily M7 (TRPM7) participates in the mobilization of Ca2+ signals within DRM regions. Thus, the findings provide insights into the underlying mechanisms that regulate Ca2+ and FAK signals in hMSCs under different mechanical microenvironments.

Partial Text

Cell‐based therapeutics are revolutionizing the medicine field.1 One promising branch is stem cell‐based therapy, which has developed from preclinical to early clinical studies for treatment of various diseases.2 Human mesenchymal stem cells (hMSCs) are a type of adult stem cells (ASCs) that are multipotent, easily accessible, and can be expanded ex vivo, providing great potential for clinical applications.3 However, insufficient stem cell adhesion and survival in vivo remains a problem, even though it can be partly addressed by tissue engineering and ex vivo genetic modifications.4 Indeed, the mechanical environment of cells, including factors such as substrate stiffness, has been shown to influence adhesion,5 which is essential for hMSC survival, proliferation, and differentiation.6 As such, the cell adhesion process not only links the extracellular matrix (ECM) and cytoskeleton chemically, but also establishes mechanical coupling between the ECM and the cell.7 Therefore, understanding the molecular mechanism of hMSC adhesion, especially in the context of its mechanical environment, is necessary for the development of scaffold and active biological materials to enhance cell adhesion for hMSC‐based therapy.

Previous evidence has shown that substrate stiffness directs hMSCs differentiation but with limited understanding on the underlying molecular mechanisms.5 Our results reveal differential Ca2+ and FAK signaling specifically occurring within DRM microdomains in hMSCs on hard and soft matrix at the initial stage of cell–matrix adhesion (Figure5a). As the adhesion process establishes the link between ECM and cytoskeleton, these initial differences can have profound effects on subsequent cellular fate. Such a study may shed light on the impact of the segregation of membrane microdomains on cellular responses to mechanical environment and on consequent functional outcomes.

Construction of DNA Plasmids: The Lyn‐FAK biosensor was generated by insertion of a raft‐targeting motif (MGCIKSKRKDNLNDDE) originated from Lyn kinase to the N‐terminus of the cytosolic‐FAK biosensor. Kras‐FAK biosensor was also constructed by insertion of a non‐raft‐targeting motif: a prenylation substrate sequence from Kras (KKKKKKSKTKCVIM) to the C‐terminus of the cytosolic‐FAK biosensor.20, 23 The DNA encoding the FAK biosensors that contain ECFP‐YPet pair were subcloned with the BamHI/EcoRI sites in pRSetB for the protein purification from Escherichia coli, and in pcDNA3.1 plasmid for the expression in mammalian cells. As FAK mutants, the kinase‐dead FAK with its kinase domain mutated (FAK KD) and the N‐terminal tail (containing 1–400 amino acids) of FAK (FAK NT) were used in this study.23 The membrane‐targeting Ca2+ biosensors based on FRET were generated in the same manner. The plasmids Lyn‐D3cpv and Kras‐D3cpv were constructed by fusion of a raft‐targeting motif: the myristoylation and palmitoylation sequence from Lyn kinase (MGCIKSKRKDNLNDDGVDMKT) to the N‐terminus of the D3cpv and a non‐raft‐targeting motif (KKKKKKSKTKCVIM) to the C‐terminus of the D3cpv.43 A dominant negative Caveolin‐1 mutant (Cav1 S80E) was used to disrupt caveolar organization.44 The caveolin‐1 was amplified by PCR and inserted into pcDNA3.1 by BamHI and EcoRI sites. The primers are forward 5′‐GCGCGGATCCGCCACCATGTCTGGGGGCAAATACGTAG‐3′ and reverse 5′‐TCCGGAATTCTTATATTTCTTTCTGCAAGTTGATG‐3′. The Cav1 S80E mutant was generated by using QuikChange Site‐Directed Mutagenesis Kit (Stratagene, La Jolla, CA).

Y.W. is a scientific co‐founder of Cell E&G Inc. D.‐H.K is a co‐founder and scientific board member of NanoSurface Biomedical Inc. However, these financial interests do not affect the design, conduct, or reporting of this research.

 

Source:

http://doi.org/10.1002/advs.201801290

 

0 0 vote
Article Rating
Subscribe
Notify of
guest
0 Comments
Inline Feedbacks
View all comments