Research Article: Transcriptional regulation of the Pseudomonas aeruginosa iron-sulfur cluster assembly pathway by binding of IscR to multiple sites

Date Published: June 28, 2019

Publisher: Public Library of Science

Author(s): Kritsakorn Saninjuk, Adisak Romsang, Jintana Duang-nkern, Paiboon Vattanaviboon, Skorn Mongkolsuk, Roy Martin Roop.

http://doi.org/10.1371/journal.pone.0218385

Abstract

Iron-sulfur ([Fe-S]) cluster proteins have essential functions in many biological processes. [Fe-S] homeostasis is crucial for bacterial survival under a wide range of environmental conditions. IscR is a global transcriptional regulator in Pseudomonas aeruginosa; it has been shown to regulate genes involved in [Fe-S] cluster biosynthesis, iron homeostasis, resistance to oxidants, and pathogenicity. Many aspects of the IscR transcriptional regulatory mechanism differ from those of other well-studied systems. This study demonstrates the mechanisms of IscR Type-1 binding to its target sites that mediate the repression of gene expression at the isc operon, nfuA, and tpx. The analysis of IscR binding to multiple binding sites in the promoter region of the isc operon reveals that IscR first binds to the high-affinity site B followed by binding to the low-affinity site A. The results of in vitro IscR binding assays and in vivo analysis of IscR-mediated repression of gene expression support the role of site B as the primary site, while site A has only a minor role in the efficiency of IscR repression of gene expression. Ligation of an [Fe-S] cluster to IscR is required for the binding of IscR to target sites and in vivo repression and stress-induced gene expression. Analysis of Type-1 sites in many bacteria, including P. aeruginosa, indicates that the first and the last three AT-rich bases were among the most highly conserved bases within all analyzed Type-1 sites. Herein, we first propose the putative sequence of P. aeruginosa IscR Type-1 binding motif as 5’AWWSSYRMNNWWWTNNNWSGGNYWW3’. This can benefit further studies in the identification of novel genes under the IscR regulon and the regulatory mechanism model of P. aeruginosa IscR as it contributes to the roles of an [Fe-S] cluster in several biologically important cellular activities.

Partial Text

Pseudomonas aeruginosa is an important environmental and human pathogenic Gram-negative bacterium. During the infection process, bacteria confront oxidative stress generated by host defense mechanisms. P. aeruginosa contains a plethora of antioxidant enzymes/proteins and reactive oxygen species (ROS)-sequestering compounds that contribute to the protection against oxidative stress and are important for bacterial proliferation and successful infections [1–6].

In our previous gene expression study, we determined that IscR functions as a transcriptional repressor on its own promoter, which supports the regulation of the iscR and the isc operon [38]. Here, the mechanism of IscR as a repressor of the isc operon was investigated. Based on computational analysis of an upstream sequence of the PAO1 iscR transcriptional start site (+1), we have proposed two putative IscR binding motifs denoted as site A (5’AATCCTGAGTAATTTGATCGGTCTT3’) and site B (5’ATAGTTGACCTAATTACTCGGATAA3’) located at positions -43 to -67 and -18 to -42, respectively ([13] and Fig 1A). Site A and site B binding motifs had 68% and 76% identity with the consensus sequence for the E. coli IscR Type-1 binding motif (5’ATASYYGACTRWWWYAGTCRRSTAT3’), respectively [19, 22]. The 5’ AT sequences of each site are among the most highly conserved bases within the Type-1 site [21, 22]. The IscR Type-1 binding site B is located between the -35 and -10 regions of the iscR promoter motifs, while site A is located upstream of the -35 regions of the promoter motif (Fig 1A). The binding of IscR to site A and/or site B would impede the binding of RNA polymerase to the promoter, leading to transcriptional repression of the isc operon. The role of these putative IscR Type-1 binding sites within the iscR promoter region and the requirement of the [Fe-S] cluster ligated IscR were further investigated in this study.

In P. aeruginosa, [2Fe-2S] cluster-ligated IscR is the active form of the regulator required for binding the Type-1 binding sites, resulting in repression of gene expression. We proposed that P. aeruginosa IscR could have different modes of binding to target sites. IscR binds to the Type-1 binding sites on the isc promoter region primarily at lower concentrations to site B and subsequently at higher concentrations to site A by either a stepwise or a cooperative mode of binding. Although, our data could not differentiate other alternative IscR binding modes, the mode of IscR binding to Type-1 sites and the number of binding sites involved in the regulation of the isc operon in P. aeruginosa are unlike the previously characterized E. coli model of IscR regulation of the operon, where IscR independently bound to either site [21]. The distinction in mode of IscR binding between PAO1 and E. coli could arise from their physiological differences, where the PAO1 genome only contains the isc operon and lacks the redundant suf and nif gene clusters [18]. The location of these Type-1 binding sites in the vicinity of the promoter provides the link between binding of the transcription regulator and gene expression. Under normal growth, IscR occupies both site B and A binding sites and hinders RNA polymerase binding to the promoter, resulting in repression of isc operon expression. This reduces the levels of enzymes available for the biosynthesis of [Fe-S] clusters and decreases new cluster synthesis and assembly. Upon exposure to inducing conditions, such as oxidative stress, higher levels of ROS react with and subsequently damage [Fe-S] clusters (Fig 7). This could result in the loss of clusters in the [Fe-S] cluster-containing proteins and/or prevent damaged clusters from being incorporated into the proteins. The presence of dual IscR binding sites with different binding affinities in the vicinity of the promoter probably affords more refined control of gene expression and rapid response under changing [Fe-S] cluster status of the bacteria. This could contribute to the dynamics in the transcriptional control of IscR under different levels of stress exposure.

 

Source:

http://doi.org/10.1371/journal.pone.0218385

 

0 0 vote
Article Rating
Subscribe
Notify of
guest
0 Comments
Inline Feedbacks
View all comments